Best for
- Works with biological sequences (DNA, RNA, protein)
- Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
- Performs sequence alignments or searches for motifs
K-Dense-AI/scientific-agent-skills/skills/scikit-bio/SKILL.md
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
Decision brief
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
Compatibility matrix
| Platform | Status | Evidence | What to check |
|---|---|---|---|
| Codex | Not declared | No explicit evidence | Portability before use |
| Claude Code | Not declared | No explicit evidence | Portability before use |
| Cursor | Not declared | No explicit evidence | Portability before use |
| Gemini CLI | Not declared | No explicit evidence | Portability before use |
Installation
The source command is displayed only when detected. A safe inspection prompt is always available so your agent can explain every action before execution.
npx skills add https://github.com/K-Dense-AI/scientific-agent-skills --skill "skills/scikit-bio"Inspect the Agent Skill "scikit-bio" from https://github.com/K-Dense-AI/scientific-agent-skills/blob/36d8f13a1e754618794bf42f417884940077b4ae/skills/scikit-bio/SKILL.md at commit 36d8f13a1e754618794bf42f417884940077b4ae. List every install step, command, network request, credential, file read/write, external action, and rollback step. Explain whether it fits my task. Do not install or execute anything until I approve.
Workflow
This skill should be used when the user: - Works with biological sequences (DNA, RNA, protein) - Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.) - Performs sequence alignments or searches for motifs - Constructs or analyzes phylogenetic tr…
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
seq = skbio.DNA.read('input.fasta')
rc = seq.reversecomplement() rna = seq.transcribe() protein = rna.translate()
Permission review
The documentation asks the agent to read local files, directories, or repositories.
Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)The documentation asks the agent to create, modify, or delete local files.
Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)The documentation asks the agent to read local files, directories, or repositories.
# Read sequences from fileThe documentation asks the agent to create, modify, or delete local files.
Read and write 19+ biological file formats with automatic format detection.Evidence record
| Signal | Value | Evidence type | Meaning |
|---|---|---|---|
| Quality score | 93/100 | Computed | Documentation, specificity, maintenance, and trust rules |
| Repository stars | 34,478 | Source | Repository attention, not individual Skill quality |
| Compatibility | 0 platforms | Source | Declared in the catalog source record |
| Usage guide | automated source guide | Editorial | Generated or reviewed according to the visible evidence level |
Pinned source
scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.
This skill should be used when the user:
Work with biological sequences using specialized classes for DNA, RNA, and protein data.
Key operations:
Common patterns:
import skbio
# Read sequences from file
seq = skbio.DNA.read('input.fasta')
# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()
# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')
# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()
Important notes:
DNA, RNA, Protein classes for grammared sequences with validationSequence class for generic sequences without alphabet restrictionsPerform pairwise and multiple sequence alignments using the pair_align engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.
Key capabilities:
pair_align_nucl (BLASTN-like) and pair_align_prot (BLASTP-like)PairAlignPath results carry CIGAR strings and convert to aligned sequencesTabularMSACommon patterns:
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA
# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score # alignment score (float)
path = aln.paths[0] # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2)) # list of gapped strings
# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))
# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local') # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3) # substitution matrix, linear gap
# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))
# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()
Important notes:
pair_align replaces the removed SSW wrapper (local_pairwise_align_ssw, StripedSmithWaterman) and the deprecated pure-Python aligners (global_pairwise_align, local_pairwise_align_nucleotide, etc.)PairAlignResult that also unpacks as score, paths, matrices (use keep_matrices=True to retain the DP matrix)sub_score accepts a (match, mismatch) tuple or a matrix name (e.g., 'NUC.4.4', 'BLOSUM62'); gap_cost accepts a single number (linear) or (open, extend) tuple (affine)PairAlignPath.from_cigar('1I8M2D5M2I'); score an existing alignment with align_score(...) and build a distance matrix from an MSA with align_dists(...)Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.
Key capabilities:
nni)cophenet, Robinson-Foulds via compare_rfd)Common patterns:
from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists
# Read tree from file
tree = TreeNode.read('tree.nwk')
# Construct tree from distance matrix
tree = nj(distance_matrix)
# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])
# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet() # patristic distance matrix among tips
# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])
Important notes:
nj() for neighbor joining (classic phylogenetic method)upgma() for UPGMA/WPGMA (assumes molecular clock)nni()cophenet() (formerly tip_tip_distances) returns the patristic distance matrix; compare_rfd() is the Robinson-Foulds method (compare_wrfd/compare_cophenet for weighted/cophenetic variants)lca() is the lowest common ancestor; lowest_common_ancestor remains as an aliasCalculate alpha and beta diversity metrics for microbial ecology and community analysis.
Key capabilities:
sobs, observed_features, chao1, ace), Shannon, Simpson, Hill numbers (hill), Faith's PD (faith_pd), generalized PD (phydiv), Pielou's evennessCommon patterns:
from skbio.diversity import alpha_diversity, beta_diversity
# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
tree=tree, taxa=feature_ids)
# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
ids=sample_ids, tree=tree, taxa=feature_ids)
# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())
Important notes:
taxa= (renamed from otu_ids in 0.6.0; the old name is a deprecated alias); observed_otus is now observed_features (or sobs)counts_matrix may be any table-like input (NumPy array, pandas/polars DataFrame, BIOM Table, or AnnData) via the dispatch systempartial_beta_diversity() for specific sample pairs, or block_beta_diversity() for large block-decomposed calculationspandas.Series, beta diversity returns a DistanceMatrixReduce high-dimensional biological data to visualizable lower-dimensional spaces.
Key capabilities:
Common patterns:
from skbio.stats.ordination import pcoa, cca
import skbio
# PCoA from distance matrix (limit dimensions for large matrices)
pcoa_results = pcoa(distance_matrix, dimensions=3)
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']
# Built-in scatter plot colored by a metadata column
fig = pcoa_results.plot(sample_metadata, column='bodysite')
# CCA with environmental variables
cca_results = cca(species_matrix, environmental_matrix)
# Save/load ordination results
pcoa_results.write('ordination.txt')
results = skbio.OrdinationResults.read('ordination.txt')
Important notes:
dimensions as an int (count) or a float in (0, 1] (fraction of cumulative variance to retain)OrdinationResults exposes pandas-based attributes: samples, features, eigvals, proportion_explained, biplot_scores, sample_constraintsOrdinationResults.plot() produces a matplotlib figure; results also integrate with seaborn/plotlyPerform hypothesis tests specific to ecological and biological data.
Key capabilities:
ancom, dirmult_ttest, and dirmult_lme (longitudinal mixed-effects) in skbio.stats.compositionCommon patterns:
from skbio.stats.distance import permanova, anosim, mantel
# Test if groups differ significantly
permanova_results = permanova(distance_matrix, grouping, permutations=999)
print(f"p-value: {permanova_results['p-value']}")
# ANOSIM test
anosim_results = anosim(distance_matrix, grouping, permutations=999)
# Mantel test between two distance matrices
mantel_results = mantel(dm1, dm2, method='pearson', permutations=999)
print(f"Correlation: {mantel_results[0]}, p-value: {mantel_results[1]}")
# Differential abundance on a feature table (raw counts recommended)
from skbio.stats.composition import dirmult_ttest
da = dirmult_ttest(counts_table, grouping, treatment='caseA', reference='control')
Important notes:
Read and write 19+ biological file formats with automatic format detection.
Supported formats:
Common patterns:
import skbio
# Read with automatic format detection
seq = skbio.DNA.read('file.fasta', format='fasta')
tree = skbio.TreeNode.read('tree.nwk')
# Write to file
seq.write('output.fasta', format='fasta')
# Generator for large files (memory efficient)
for seq in skbio.io.read('large.fasta', format='fasta', constructor=skbio.DNA):
process(seq)
# Convert formats
seqs = list(skbio.io.read('input.fastq', format='fastq', constructor=skbio.DNA))
skbio.io.write(seqs, format='fasta', into='output.fasta')
Important notes:
into parameter specifiedverify=FalseCreate and manipulate distance/dissimilarity matrices with statistical methods.
Key capabilities:
DistanceMatrix, hollow diagonal) or general pairwise (PairwiseMatrix) dataCommon patterns:
from skbio import DistanceMatrix
import numpy as np
# Create from array
data = np.array([[0, 1, 2], [1, 0, 3], [2, 3, 0]])
dm = DistanceMatrix(data, ids=['A', 'B', 'C'])
# Access distances
dist_ab = dm['A', 'B']
row_a = dm['A']
# Read from file
dm = DistanceMatrix.read('distances.txt')
# Use in downstream analyses
pcoa_results = pcoa(dm)
permanova_results = permanova(dm, grouping)
Important notes:
DistanceMatrix enforces symmetry and a zero (hollow) diagonal; it is a subclass of SymmetricMatrixPairwiseMatrix (renamed from DissimilarityMatrix, which is kept as a deprecated alias) allows general/asymmetric valuesWork with feature tables (OTU/ASV tables) common in microbiome research.
Key capabilities:
Table classtable_like input — BIOM Table, pandas/polars DataFrame, NumPy array, or AnnData — without explicit conversionphylomix, mixup, aitchison_mixup, compos_cutmix)Common patterns:
from skbio import Table
from skbio.diversity import beta_diversity
# Read BIOM table
table = Table.read('table.biom')
# Access data
sample_ids = table.ids(axis='sample')
feature_ids = table.ids(axis='observation')
counts = table.matrix_data
# Filter
filtered = table.filter(sample_ids_to_keep, axis='sample')
# Pass table-like objects directly to scikit-bio drivers (dispatch system)
import pandas as pd
df = pd.read_table('data.tsv', index_col=0) # samples x features
bdiv = beta_diversity('braycurtis', df) # no manual conversion needed
Important notes:
Work with protein language model embeddings for downstream analysis.
Key capabilities:
Common patterns:
from skbio.embedding import ProteinEmbedding, ProteinVector
# Create embedding from array
embedding = ProteinEmbedding(embedding_array, sequence_ids)
# Convert to distance matrix for analysis
dm = embedding.to_distances(metric='euclidean')
# PCoA visualization of embedding space
pcoa_results = embedding.to_ordination(metric='euclidean', method='pcoa')
# Export for machine learning
array = embedding.to_array()
df = embedding.to_dataframe()
Important notes:
uv pip install scikit-bio
Requires Python 3.10+ and NumPy 2.0+. Pre-compiled wheels are published for each release since 0.7.0, so most platforms install without a compiler. Conda users can instead run conda install -c conda-forge scikit-bio.
partial_beta_diversity()For detailed API information, parameter specifications, and advanced usage examples, refer to references/api_reference.md which contains comprehensive documentation on:
Frequently asked questions
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
The source record exposes this install command: npx skills add https://github.com/K-Dense-AI/scientific-agent-skills --skill "skills/scikit-bio". Inspect the command and pinned source before running it.
Static rules flagged read-files, write-files in the source; the page lists the matching lines and excerpts.
Alternatives
synthetic-sciences/openscience
Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.
K-Dense-AI/scientific-agent-skills
Distributed computing for larger-than-RAM pandas/NumPy workflows. Use when you need to scale existing pandas/NumPy code beyond memory or across clusters. Best for parallel file processing, distributed ML, integration with existing pandas code. For out-of-core analytics on single machine use vaex; for in-memory speed use polars.
K-Dense-AI/scientific-agent-skills
Use NeuroKit2 to build or audit reproducible research workflows for physiological time-series preprocessing, event/interval analysis, multimodal alignment, variability, and complexity. Trigger when code imports neurokit2 or needs its current APIs, schemas, and method-aware validation—not for diagnosis or device validation.
Aperivue/medsci-skills
Generate publication-ready figures and visual abstracts for medical research papers. Supports ROC curves, forest plots, CONSORT/STARD/PRISMA flow diagrams, calibration plots, Kaplan-Meier curves, Bland-Altman plots, confusion matrices, pipeline diagrams, and journal-specific visual/graphical abstracts (python-pptx template-based).